Write a program that prints a text of 4 lines consisting of characters, integer values and floating-point values using cout statement?

Click on youtube link to see the solution https://youtu.be/Qc5j0VD60WE?feature=shared

Comments

Post a Comment

Popular posts from this blog

Kruskul's Algorithm

Image
  Definition: Kruskal's algorithm for finding the shortest forest of non-directional edge-weighted graphs If the graph is connected, it finds the minimum spanning tree. . consists of a minimum spanning tree for each connected component.) Greedy algorithms in graph theory add the lowest weight edge that will not form a loop in the spanning forest at least at each step. Algorithm: create a forest (a set of trees), where each vertex in the graph is a separate tree create a sorted set containing all the edges in the graph while sorted set is nonempty and set of tree is not yet spanning Remove an edge with minimum weight from sorted set If the edge is removed to join two different trees, combine the two trees into one tree and add it to the  forest After the algorithm is finished, the forest forms the least sparse forest of the graph. If the graph is connected, then the forest has a subset and forms a minimum spanning tree. YouTube Video  Click here to see video how to solve ...
Read more

Minimum Edit Distance

Image
The minimum edit distance between two strings Is the minimum number of editing operations. Insertion Operation Deletion Operation Substitution Operation       Needed to transform one string into the other string. Two strings and their alignment:    If each operation has cost of 1, Distance between these is 5 If substitutions cost 2 (Levenstein), Distance between them is 8  Alignment in Computational Biology Given a sequence of bases AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC  An alignment: Given two sequences, align each letter to a letter or gap How to find the Minimum Edit Distance ? Searching for a path (sequence of edits) from the start string to the final string: ◦ Initial state: the word we’re transforming  ◦ Operators: insert, delete, substitute  ◦ Goal state: the word we’re trying to get to  ◦ Path cost: what we want to minimize: the number of edits  You can also see the video of solving minimum e...
Read more